1. INTRODUCTION:

Members of the Campylobacter genus are gram-negative, mainly spiral-shaped, motile bacteria that grow in microaerophilic conditions (Quinn et al., 2011). Human Campylobacteriosis is the most common bacterial food-borne disease, characterized by diarrhea, fever, and abdominal cramps (Facciolà et al., 2017). Campylobacters can colonize the digestive tract of poultry and other farm animals as commensal and symptomless bacteria. During meat and food chain processes, they contaminate the meat and food materials (Kaakoush et al., 2015). Poultry, especially broiler chicken, has the primary role in Campylobacteriosis, and significant cases of the disease occur when dealing with raw poultry meat (Mughini Gras et al., 2012).

Campylobacteriosis is mainly caused by C. jejuni approximately (80- 90%) and Campylobacter coli (C. coli) (8-10%) and, at fewer rates, by Campylobacter lari and another Campylobacter species (Michael P. Doyle, 2013). C. jejuni is a fastidious growth bacterium that can quickly lose viability and culturability (Ghaffar et al., 2015). It needs microaerobic conditions for growth (the concentration of O₂ must be reduced to around 5%, and the concentration of CO₂ must increase to around 10%. It can grow at a temperature range of 30 to 45°C, though its optimum growth is 42°C, so it is arranged as a thermophilic Campylobacter. It has many selective growth media that mainly depend on composition that reduces the harmful effects of oxygen and antibiotic supplements, enhancing their chance of competition (Quinn et al., 2011). The selective medium, modified charcoal cefoperazone deoxycholate agar (mCCDA), which contains cefoperazone and amphotericin B, is perhaps the most frequently employed to isolate C. jejuni and C. coli (Griffiths, 1993). The increase of antibiotic-resistant Campylobacters worrying worldwide. The studies in the Middle East show that many Campylobacter isolates are highly resistant to quinolones and tetracycline (Mouftah et al., 2021). Increased antibiotic-resistance Campylobacter has usually been related to the excessive use of antibiotics in farm fields (Abukhattab et al., 2022; McCrackin et al., 2016).

Broiler meat is one of the familiar sources of nutrition protein in Duhok province; while people previously mainly depended on imported frozen chicken but there is a great change in inclination noticeable toward local raw broiler meat. This study aimed to open an eyelet for a better understanding of the epidemiology and antimicrobial resistance of Campylobacter in Duhok region through isolation and identification of C. jejuni from chickens in local traditional small poultry abattoirs and imported frozen chickens, molecular identification of isolated bacteria comparing with the standard references’ strains and antibacterial sensitivity test examination.

2. MATERIALS AND METHODS:

2.1 Samples Collection:

The current study was performed from December 2022 to July 2023. Cloacal swabs were used to collect samples from one hundred and fifty broiler chickens in ten different traditional poultry abattoirs. Sterile transport swabs (Nacoxm, China) were used; the sheath of the swabs had previously been fielded aseptically with 5 ml of Buffered Peptone Water (BPW) (Himedia, India). Also, seventy-five whole frozen chickens were collected from diverse markets and supermarkets in the Duhok Region. All samples were brought to the Sumeil Veterinary Center's laboratory within two hours for primary isolation of Campylobacter.

2.2 Isolation of C. jejuni and bacteriological identification

Campylobacter was isolated using both direct and indirect methods. Hundred swabs were processed indirectly from the swabs that were taken. Briefly, one ml of BPW that is used as transport media and added to a capping vial contains 9 ml of Modified Bolton Broth (MBB), composed of Bolton broth base (Himedia, India) with CCDA selective supplements (amphotericin B 5.0 mg and cefoperazone 16.0 mg) (Oxoid, UK) without blood. The caps of each vial were loosened and incubated in the Gas Jar (GJ) (Oxoid, UK) under microaerophilic conditions generated by a Campygen microaerophilic Gas Pack (GP) (2.5 liters) (Oxoid, UK) at 37 °C for 4 hours, followed by an extended 20 hours at 42 °C. A loopful of each enriched sample was streaked on mCCDA plates composed of Campylobacter blood-free selective agar base CM0739 and CCDA selective supplement(contains cefoperazone and amphotericin B) SR0155 (Oxoid, UK) agar plates, which were then put in an incubator at 42°C under microaerophilic conditions generated in the same way for 48 hours. Fifty swabs were directly streaked on mCCDA plates and incubated in microaerophilic conditions generated using gas jar (GJ) and gas pack (GP) at 42 °C for 48 hours.

The indirect method was used for imported frozen chicken (IFC). Briefly, in the laboratory with an aseptic scalpel and forceps, each chicken was removed from its original case and placed in clean, zipped food bags. 200 ml of BPW was added to each case and shaken by hands for 3 minutes; the chicken was removed, and the remaining fluid in the case was brought for examination. Three milliliter of each sample was put into a sterile glass vial that held 17 ml of MBB enrichment medium were incubated for 48 hours in microaerobic conditions generated as previously described at 42°C. A loopful of enriched media was streaked on mCCDA and incubated under the same conditions for 48 hours.

For both types of samples, mCCDA Plates that appear to have had weak growth and have undefinable colonies were sub-cultured on another mCCD agar plate by taking a loop in a cross line from the center of the growth area. One suspected separate colony is taken from each plate with growing bacteria, spreads on a Blood Agar (BA) composed of blood agar base (Liofilchem, Italy) with 10% defibrinated sheep blood plate and left to grow for 48 hours in the same conditions previously described.

Campylobacter is identified primary based on colony morphology and bacterial morphology under microscopy. Gram stain (Atom Scientific, UK) used and prepared slides were air dried and examined under light microscope at 100× oil immersion magnification. Small, Gram negative, pink colored, curved cells indicated that the isolate was likely to be Campylobacter. Slide based Motility test was conducted to identify the typical movement of Campylobacter under the light microscope. Isolated samples were stored at -20°C in brain-heart infusion broth with 15% glycerol for further testing (Gorman et al., 2004).

2.3 DNA Extraction

DNA was extracted from the bacteriologically confirmed isolates taken from fresh culture on BA agar plates. The isolation of DNA was done by using the boiling method with some modifications(Ahmed et al., 2017), briefly collected colonies suspended in 1% TAE buffer, and heated at 95°C in a heat block (company, country) for 20 min. The samples were then centrifuged at 10,000 rpm for 10 min. The supernatants are used as DNA templates for PCR. Nanodrop (Thermofisher, UK) was used to assess the quantity and quality of DNA.

2.4 Molecular Detection

DNA was extracted from all the bacterial isolates for molecular detection and identification of C. jejuni using polymerase chain reaction (PCR) with the indicated primers from hipo Species-specific gene (Table1).

The PCR reaction was made by 10 µl master mix (JenaBiosciences, Germany), 1µl of each primer (10 pmol/µl), 2µl of extracted DNA (50 ng/µl), and 6 µl of PCR-grade water. The following conditions were used to amplify PCR using (Applied Biosystem, UK) thermocycler: An initial denaturation step at 95°C for 5 minutes was followed by 35 cycles of amplification (denaturation at 95°C for 0.5 minute, annealing at 53°C for 0.5 minute, and extension at 72°C for 0.5 minute), followed by final extension at 72°C for 7 minutes.

2.5 Amplification of 16S rRNA

Conventional PCR was also carried out for identification of C. jejuni using 16S rRNA, DNA extracts from 12 confirmed C. jejuni isolates from both sources and 8 non-Campylobacter competitive bacteria from IFC were checked; primers for the 16S rRNA ribosomal RNA were used as shown in (Table1).

The PCR reaction solution was prepared from 20µl master mix (JenaBiosciences, Germany), 2.5 µl from each primer (10pmol/ µl), about 4µl of DNA extraction (50ng/µl), and PCR grade water, was added to make it 40µl. The amplification condition was as follows: Initial denaturation at 94°C for 5 minutes, then 35 cycles of amplification (denaturation at 94°C for 45 seconds, annealing at 50°C for 60 seconds, and extension at 72°C for 90 seconds), followed by a final extension at 72°C for 10 minutes. (Applied Biosystem, UK) thermocycler.

2.6 Agarose gel electrophoresis

DNA was routinely analyzed by subjecting PCR products for electrophoresis in 1.5% (w/v) agarose gel using 1X Tris-acetate, EDTA buffer (1× TAE) with nucleic acid dye, Safe dye (JenaBiosciences, Germany). Five microliters of each PCR product were loaded into each well with loading of 7 µl of 100bp DNA ladder (Jena Bioscience, Germany). The nucleic acid fragments sizes were viewed by using UV transilluminators (Fisher scientific, USA).

2.7 Sequencing of 16S rRNA and Phylogenic tree construction

To determine the similarity between the isolates from different niches, 17 isolates from LBC and three from IFC were amplified using primers targeting the conserved region of the 16S rRNA gene for identification of the C. jejuni. The PCR products were purified and sequenced. These samples were sequenced using sanger sequencing (Macrogen, South Korea). Chromatogram files were received, and the quality of sequences were evaluated, bad quality sequences were trimmed out using Bioedit software. A BLAST search was performed, and the sequences were compared to known Campylobacter sequences in the GenBank. Final sequences were deposited to NCBI/GenBank, and accession numbers were received (Table 2). Multiple alignments were done with the Clustal-W method (Thompson et al., 1994), and MEGA XI was used to make a phylogenetic analysis with Neighbor-Joining. The bootstrap measures were determined from 1000 repeats of the original data (Kumar et al., 2018).

Table 2: Accession Number and isolation sources of submitted C. Jejuni isolates of this study.

No.	Isolation Source	Sample ID	Accession Numbers
1.	Whole frozen chicken	NC1	OP412479
2.	Whole frozen chicken	NC2	OP412445
3.	Whole frozen chicken	NC11	OP412446
4.	Chicken faecal sample	NF11	OP415426
5.	Chicken faecal sample	NF10	OP415425
6.	Chicken faecal sample	NF9	OP415387
7.	Chicken faecal sample	NF8	OP415415
8.	Chicken faecal sample	NF7	OP415417
9.	Chicken faecal sample	NF6	OP415406
10.	Chicken faecal sample	NF5	OP415398
11.	Chicken faecal sample	NF4	OP415388
12.	Chicken faecal sample	NF3	OP415394
13.	Chicken faecal sample	NF2	OP415396
14.	Chicken faecal sample	NF1	OP415411

2.8 Antibiotic Sensitivity testing (AST)

Antibiotic sensitivity test (AST) was performed using the desk diffusion method in accordance with the CLSI-M45 and BSAC Methods for Antimicrobial Susceptibility Testing Protocols (CLSI, 2015; Howe et al., 2012). The bacteria recovered from glycerol broth storage on BA were suspended in Bolton base broth to obtain the inoculated broth having suitable turbidity approximately (0.5 McFarland standard), which was streaked on Mueller Hinton Agar (MHA) plates composed from Mueller Hinton Agar I (Neogen, USA) with 5% defibrinated sheep blood agar plates and was incubated under microaerophilic condition for 48 hours. The following antibiotics desks were used : Nalidixic acid (NA) 30 µg, Oxytetracycline (OT) 30 µg, Erythromycin (E) 15 µg, Gentamycin (CN) 30 µg, Ciprofloxacin (CIP) 5 µg and Tetracycline (TE) 30 µg.

3. RESULTS:

Campylobacters were identified in 30% (45/150) of the samples collected from local broiler chicken from which 9% (9/100) were isolated using enrichment method, while 72% (36/50) were isolated using direct method without enrichment. In line with this, 75 frozen imported chickens from Brazil (30) and Turkey (45) were sampled and tested for C. jejuni isolation. C. jejuni isolated only in three imported chickens from Turkey (4/75) (Table2). The isolation of C. jejuni was first based on colonies morphology, Gram stain and motility test, then these samples were subjected to PCR for further confirmation using species specific gene for C. jejuni detection. Molecular detection by PCR showed that 24 of the isolates from LBC (4 from enrichment and 20 from direct method) and 2 of the isolates from IFC-Turkey were confirmed to be C. jejuni (Table 3 and Figure 2).

The evolutionary history was inferred using the Neighbor-Joining method. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Jukes-Cantor method and are in the units of the number of base substitutions per site. Evolutionary analyses were conducted in MEGA11.4.

4. DISCUSSION:

Broiler chicken is considered the major source of Campylobacteriosis (Newell et al., 2017). However, molecular methods, particularly multiplex PCR, have become more simple and time-efficient, but the culture method is still the primary step for bacterial isolation and demonstration of the further evolution of epidemiology and virulence disease factors (Ricke et al., 2019). Campylobacter isolation rates can vary greatly depending on geographical distribution, season, and the methods of sampling and isolation (Kaakoush et al., 2015). In this study, both direct and indirect (enrichment) methods were applied for the isolation of Campylobacter from swabs taken from LBC. Only 9% (9/100) of the sample taken from LBC through enrichment methods was identified as Campylobacter. Divsalar et al., (2019) obtained a higher level of isolation by the enrichment method using Preston broth and Colombia agar in Iran. The isolation rate in 35-day-old broiler chickens was 30% (15/50) in Jordan using Bolton broth and Preston agar (Neves et al., 2018). The low rate of indirect isolation in the present study could be attributed to improper selective supplements in enrichment broth, which provide the chance for competitive bacteria to grow and adapt to the growing conditions. The rate of Campylobacter jejuni isolation is significantly higher in direct methods compared to enrichment methods (72% versus 9%). Previous research demonstrated that a cloacal swab and direct streaking on mCCDA could be used to obtain a higher rate of Campylobacter isolates (Urdaneta et al., 2015; Vaz et al., 2014). In this study, 72% (36/50) of the samples taken from LBC by direct methods had distinctive Campylobacter growth and appearance. The result is very similar to the result of Vaz et al. (2014) who demonstrated 72.2% (26/36) of Campylobacter by the use of the same direct method in Brazil, but quite different from the results of a study done in Iraq by Shakir et al. (2021) who found that the isolation rate from 150 cloacal swabs and ceca from broiler farms and chicken in live chicken markets was 24% by using a direct method on Campylobacter agar base with selective supplements.

In this study, from isolated Campylobacter, 55.56% (20/36) were confirmed as C. jejuni by PCR, whereas Neogi et al. (2020) found that the C. jejuni ratio from Campylobacter ssp. isolated from broiler chicken was 65% (24/37) in Bangladesh. Staji et al. (2018) detected 46.8% C. jejuni by using PCR from 64 isolates that were biochemically identified as Campylobacter species from broiler fecal samples. In the current study, from IFC, only 3 out of 75 (4%) were characterized as Campylobacter, and only 2 confirmed cases of C. jejuni were obtained. It has been proven that freezing clearly decreases the viability and capturability of Campylobacter (Georgsson et al., 2006; Oh et al., 2019). Industrial rapid freezing and long-term storage of broiler meat can significantly reduce the detectable Campylobacter percentage, even to zero (Yu et al., 2021). This information indicates the low level of detection of Campylobacter from IFC that was from Turkey and zero isolates from IFC that were from Brazil since products from Turkey usually reach Iraq during the first month of production while products from Brazil usually need more time to reach Iraq, usually, more than 2 months. A similar result was obtained in a study conducted by Alaboudi et al. (2020) in Jordan which examined 59 whole imported frozen chickens collected from local markets for the prevalence of Campylobacter species but found none.

In this study, nine recovered C. jejuni isolates from local broiler chickens as well as two recovered C. jejuni isolates from IFC showed similar antibiotic resistance patterns. All 11 samples (100%) from both origins were strongly resistant to TE, CIP, NA and OT but susceptible to E and G (Table3). In spite of the small sample size, these results are not surprising, since the high resistance of Campylobacter toward quinolones and tetracyclines and a low level of resistance toward macrolides and aminoglycoside have been demonstrated in other studies in the Middle East. Divsalar et al., (2019) discovered resistance to TE and CIP in all 40/40 (100%) isolated C. jejuni from broiler chicken and broiler meat in Iran. In Jordan, (Alaboudi et al., 2020) found 13/13 (100%) resistance toward CIP. Similarly detected in Iraq, among 36 biochemically isolated Campylobacter, 100% were resistant to CIP and NA and 88.8% to Tetracycline (Shakir et al., 2021). Additionally, in these three previously mentioned studies, the resistances to GE were 7.5%, 12%, and 30.5%, respectively, and the resistances to E were shown as 7.5% by (Divsalar et al., 2019) and 50% by (Shakir et al., 2021). The higher level of E resistance in the study conducted by (Shakir et al., 2021) may be due to the biochemical confirmation of Campylobacter to the genus level, and this high level of resistance may be related to C. coli, which, unlike C. jejuni, has a significant high resistance toward E (Authority et al., 2022).

Despite of the fact that 16S rDNA analysis enables specific identification of most Campylobacter species. However, due to the lack of discrimination among the taxa the Campylobacter jejuni, C. coli and atypical C. lari strains were excluded because they shared identical or nearly identical 16S rDNA sequences (Parkhill et al., 2000). Hansson et al., 2008 stated that phylogenetic analysis based on 16S rRNA sequences is not always sufficient for differentiation between C. jejuni and C. coli. Therefore, the construction of phylogenetic tree in this study was based only on confirmed C. jejuni strains and compared with other C. jejuni strains subjected to GenBank. This study has found that all LBC and IFC isolates are closely related as they shared 97-99% similarity. The study isolates also have shown a variation in their relatedness with the other isolates in other countries and with other isolation sources. The strains were grouped in five major clusters, but the majority were grouped in cluster I, including one IFC and other strains from other countries as in cluster one ,CP012242-Finland, OP090654- Croatia and CP030866-Chicken- from South Korea. While the other strains grouped in cluster III and IV with the C. jejuni strains of other countries, APO26014-Japan, EF136573-India, and MN736598-Chicken feces from Italy. This could be due to the lack of risk analysis and control measures applied for the importation of eggs for hatching and importation of frozen chicken.

5. CONCLUSION

This study focused on the occurrence of C. jejuni in Cloacal swabs of broiler chicken and imported frozen chicken samples collected from different sources. These can serve as a possible source for transmitting of C. jejuni and increase the risk of campylobacteriosis in humans through the consumption of undercooked meat. The current study has identified that C. jejuni isolated from LBC and IFC were developed an antimicrobial resistance for certain antibiotics and considered as multidrug resistant strains, which increases the concerns for the authorities. Therefore, necessary measures at different stages in the food chain are required to minimize or remove the risks caused by this pathogen. In addition, using of antibiotics must be regulated and careful in both veterinary and human treatment. The isolated strains are genetically closely related from different sources. This study had some limitations due to the fund and time restraint . Thus additional molecular epidemiology, phenotypical and molecular identification for this microorganism are needed.

REFERENCES:

Abukhattab, S., Taweel, H., Awad, A., Crump, L., Vonaesch, P., Zinsstag, J., Hattendorf, J., & Abu-Rmeileh, N. M. E. (2022). Systematic Review and Meta-Analysis of Integrated Studies on Salmonella and Campylobacter Prevalence, Serovar, and Phenotyping and Genetic of Antimicrobial Resistance in the Middle East—A One Health Perspective. Antibiotics, 11(5). doi: 10.3390/antibiotics11050536

Ahmed, O. B., & Dablool, A. S. (2017). Quality Improvement of the DNA extracted by boiling method in Gram negative bacteria. International Journal of Bioassays, 6(04), 5347. doi: 10.21746/ijbio.2017.04.004

Alaboudi, A. R., Malkawi, I. M., Osaili, T. M., Abu-Basha, E. A., & Guitian, J. (2020). Prevalence, antibiotic resistance and genotypes of Campylobacter jejuni and Campylobacter coli isolated from chickens in Irbid governorate, Jordan. International Journal of Food Microbiology, 327, 108656. doi: 10.1016/j.ijfoodmicro.2020.108656

Authority, E. F. S., & Control, E. C. for D. P. and. (2022). The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2019–2020. EFSA Journal, 20(3), e07209. doi: https://doi.org/10.2903/j.efsa.2022.7209

Boelsen, L. K., Dunne, E. M., Mika, M., Eggers, S., Nguyen, C. D., Ratu, F. T., Russell, F. M., Mulholland, E. K., Hilty, M., & Satzke, C. (2019). The association between pneumococcal vaccination, ethnicity, and the nasopharyngeal microbiota of children in Fiji. Microbiome, 7(1), 1–16. doi: 10.1186/s40168-019-0716-4

CLSI. (2015). Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria. (Clinical and Laboratory Standards Institute CLSI guideline M45. (ed.); 3rd ed.). Wayne: PA: Clinical and Laboratory Standards Institute;

Divsalar, G., Kaboosi, H., Khoshbakht, R., Shirzad-Aski, H., & Ghadikolaii, F. P. (2019). Antimicrobial resistances, and molecular typing of Campylobacter jejuni isolates, separated from food-producing animals and diarrhea patients in Iran. Comparative Immunology, Microbiology and Infectious Diseases, 65(December 2018), 194–200. doi: 10.1016/j.cimid.2019.06.001

Facciolà, A., Riso, R., Avventuroso, E., Visalli, G., Delia, S. A., & Laganà, P. (2017). Campylobacter: From microbiology to prevention. Journal of Preventive Medicine and Hygiene, 58(2), E79–E92. doi: 10.15167/2421-4248/jpmh2017.58.2.672

Georgsson, F., Þorkelsson, Á. E., Geirsdóttir, M., Reiersen, J., & Stern, N. J. (2006). The influence of freezing and duration of storage on Campylobacter and indicator bacteria in broiler carcasses. Food Microbiology, 23(7), 677–683. doi: https://doi.org/10.1016/j.fm.2005.10.003

Ghaffar, N. M., Connerton, P. L., & Connerton, I. F. (2015). Filamentation of Campylobacter in broth cultures . In Frontiers in Microbiology (Vol. 6).

Gorman, R., & Adley, C. C. (2004). An evaluation of five preservation techniques and conventional freezing temperatures of -20°C and -85°C for long-term preservation of Campylobacter jejuni. Letters in Applied Microbiology, 38(4), 306–310. doi: 10.1111/j.1472-765X.2004.01490.x

Griffiths, P. L. (1993). Morphological changes of Campylobacter jejuni growing in liquid culture. Letters in Applied Microbiology, 17(4), 152–155. doi: 10.1111/j.1472-765x.1993.tb00382.x

Hansson, I., Persson, M., Svensson, L., Engvall, E. O., & Johansson, K. E. (2008). Identification of nine sequence types of the 16S rRNA genes of Campylobacter jejuni subsp. jejuni isolated from broilers. Acta Veterinaria Scandinavica, 50(1), 1–10. doi: 10.1186/1751-0147-50-10

Howe, R. A., & Andrews, J. M. (2012). BSAC standardized disc susceptibility testing method (version 11). The Journal of Antimicrobial Chemotherapy, 67(12), 2783–2784. doi: 10.1093/jac/dks391

Kaakoush, N. O., Castaño-Rodríguez, N., Mitchell, H. M., & Man, S. M. (2015). Global Epidemiology of Campylobacter Infection. doi: 10.1128/CMR.00006-15

Kim, S. M., Kim, E. C., Choi, M. R., So, H. A., Shim, E. S., Kim, E. S., Park, S. C., Seong, C. N., & Chong, Y. (2008). Cytolethal distending toxin production, genotypes and atimicrobial susceptibility of Campylobacter jejuni isolates from diarrhea patients and chickens. Journal of Bacteriology and Virology, 38(4), 207–219. doi: 10.4167/jbv.2008.38.4.207

Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6), 1547–1549. doi: 10.1093/molbev/msy096

Magiorakos, A., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., Harbarth, S., & Hindler, J. F. (2011). Bacteria : an International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clinical Microbiology and Infection, 18(3), 268–281.

McCrackin, M. A., Helke, K. L., Galloway, A. M., Poole, A. Z., Salgado, C. D., & Marriott, B. p. (2016). Effect of Antimicrobial Use in Agricultural Animals on Drug-resistant Foodborne Campylobacteriosis in Humans: A Systematic Literature Review. Critical Reviews in Food Science and Nutrition, 56(13), 2115–2132. doi: 10.1080/10408398.2015.1119798

Michael P. Doyle, R. B. (2013). Food microbiology : fundamentals and frontiers (4th ed.). Washington: ASM Press.

Mughini Gras, L., Smid, J. H., Wagenaar, J. A., de Boer, A. G., Havelaar, A. H., Friesema, I. H. M., French, N. P., Busani, L., & van Pelt, W. (2012). Risk factors for campylobacteriosis of chicken, ruminant, and environmental origin: A combined case-control and source attribution analysis. PLoS ONE, 7(8). doi: 10.1371/journal.pone.0042599

Neogi, S. B., Islam, M. M., Islam, S. K. S., Akhter, A. H. M. T., Sikder, M. M. H., Yamasaki, S., & Kabir, S. M. L. (2020). Risk of multi-drug resistant Campylobacter spp. and residual antimicrobials at poultry farms and live bird markets in Bangladesh. BMC Infectious Diseases, 20(1), 278. doi: 10.1186/s12879-020-05006-6

Neves, M. I., Malkawi, I., Walker, M., Alaboudi, A., Abu-Basha, E., Blake, D. P., Guitian, J., & Crotta, M. (2018). Epidemiology and Infection The transmission dynamics of Campylobacter jejuni among broilers in semi-commercial farms in Jordan. doi: 10.1017/S0950268818003308

Newell, D. G., Mughini-Gras, L., Kalupahana, R. S., & Wagenaar, J. A. (2017). Campylobacter epidemiology-sources and routes of transmission for human infection. In Campylobacter: Features, Detection, and Prevention of Foodborne Disease. Elsevier Inc. doi: 10.1016/B978-0-12-803623-5.00005-8

Oh, E., Andrews, K. J., McMullen, L. M., & Jeon, B. (2019). Tolerance to stress conditions associated with food safety in Campylobacter jejuni strains isolated from retail raw chicken. Scientific Reports, 9(1), 1–9. doi: 10.1038/s41598-019-48373-0

Parkhill, J., Wren, B. W., Mungall, K., Ketley, J. M., Churcher, C., Basham, D., Chillingworth, T., Davies, R. M., Feltwell, T., Holroyd, S., Jagels, K., Karlyshev, A. V., Moule, S., Pallen, M. J., Pennk, C. W., Quail, M. A., Rajandream, M.-A., Rutherford, K. M., van Vliet, A. H. M., … Barrell, B. G. (2000). The genome sequence of C. jejuni. Nature, 403(6770), 665–668.

Quinn, P. J., Markey, B. K., Carter, M. E., Donnelly, W. J. C., & Leonard, F. C. (2011). veterinary microbiology and microbial disease ( Second Edition ) (second).

Ricke, S. C., Feye, K. M., Chaney, W. E., Shi, Z., Pavlidis, H., & Yang, Y. (2019). Developments in Rapid Detection Methods for the Detection of Foodborne Campylobacter in the United States . In Frontiers in Microbiology (Vol. 9).

Shakir, Z. M., Alhatami, A. O., Ismail Khudhair, Y., & Muhsen Abdulwahab, H. (2021). Antibiotic Resistance Profile and Multiple Antibiotic Resistance Index of Campylobacter Species Isolated from Poultry. Archives of Razi Institute, 76(6), 1677–1686. doi: 10.22092/ari.2021.356400.1837

Staji, H., Birgani, S. F., & Raeisian, B. (2018). Comparative clustering and genotyping of Campylobacter jejuni strains isolated from broiler and turkey feces by using RAPD-PCR and ERIC-PCR analysis. Annals of Microbiology, 68(11), 755–762. doi: 10.1007/s13213-018-1380-9

Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22(22), 4673–4680. doi: 10.1093/nar/22.22.4673

Urdaneta, S., Dolz, R., & Cerdà-Cuéllar, M. (2015). Assessment of two different types of sample for the early detection and isolation of thermophilic Campylobacter in broiler farms. Avian Pathology, 44(2), 103–105. doi: 10.1080/03079457.2015.1006576

Vaz, C. S. L., Voss-Rech, D., Pozza, J. S., Coldebella, A., & S. Silva, V. (2014). Isolation of Campylobacter from Brazilian broiler flocks using different culturing procedures. Poultry Science, 93(11), 2887–2892. doi: 10.3382/ps.2014-03943

Yu, Z., Joossens, M., Kerkhof, P. J., & Houf, K. (2021). Bacterial shifts on broiler carcasses at retail upon frozen storage. International Journal of Food Microbiology, 340(July 2020), 109051. doi: 10.1016/j.ijfoodmicro.2021.109051

Primer Name	Gene	Sequence (5’-3’)	Amplicon Size (bp)	References
515f	16S rRNA	GTGCCAGCMGCCGCGGTAA	*~ 250-300	(Boelsen et al., 2019)
806r		GGACTACHVGGGTWTCTAAT
Hipo	hipO gene	ACTTCTTTATTGCTTGCTGC	323	(Kim et al., 2008)
		GCCACAACAAGTAAAGAAGC

Sample type		No. of samples		% of C. jejuni confirmed phenotypically		% of Confirmed C. jejuni by PCR
Sample type		No. of samples		No.	%	No.	% Per phenotypically confirmed isolates	Overall %
LBC	Enrichment method	150	100	9	9%	4	44.44%	4.00%
LBC	Direct method	150	50	36	72%	20	55.56%	40.00%
IFC	From Turkey	75	45	3	7%	2	66.67%	4.44%
IFC	From Brazil	75	30	0	0%	0	0.00%	0.00%

ABSTRACT: