MOLECULAR DETECTION OF DRUG-RESISTANT GENES AMONG Clostridioides difficile FROM DIARRHEIC CHILDREN IN DUHOK CITY -IRAQ
Bakhtyar Nader Ali1,*
1 Department of Biology, College of Science, University of Duhok, Duhok, Kurdistan Region, Iraq
*Corresponding Author email: bakhtyar.ali@uod.ac
Received: 28 Oct 2024 Accepted:25 Mar 2025 Published:10 Apr 2025 https://doi.org/10.25271/sjuoz.2025.13.2.1424
ABSTRACT:
Clostridioides difficile, formerly known as Clostridium difficile is the most common cause of antibiotic-associated diarrhea and colitis and is characterized by resistance to multiple drugs. This study amid to characterize antibiotic resistance genes in C. difficile among pediatric diarrheal cases from Duhok Governorate, Kurdistan regional Iraq, providing critical insights for regional infection control and treatment guidelines. Thirteen C. difficile-positive stool samples (from a cohort of 200 children aged between 6 months- 6 years) were analysed by PCR for detecting resistance genes CTX-M (cefotaxime), ermC (clindamycin), ere(A) (erythromycin), rdxA (metronidazole), vanR (vancomycin). The result illustrated that cefotaxime, CTX-M gene detected in 100% DNA samples, with high rates of resistance of clindamycin (ermC gene, 76.9%) and erythromycin (69.2%, ere(A) gene) while resistance to metronidazole (rdxA) and vancomycin resistance (vanR) remained rare (7,69% and 15.38%, respectively). Venn diagram analysis highlighted frequent co-occurrence of resistance to these genes, and six samples (46.2%) harbored three genes, CTX-M, ermC and ere (A), and also double other two samples harbored two genes, CTX-M and ermC and CTX-M and ere (A). In addition, one sample harbored only the CTX-M gene. This study underscores the prevalence of the alarming high rate of antibiotic resistance found in C. difficile among pediatric diarrheal cases such as against cefotaxime, clindamycin, and erythromycin. The persistence of susceptibility to vancomycin and metronidazole supports their continued use as first-line therapies for both community and hospital infections region.
KEYWORDS: Clostridioides Difficile, Antibiotic-Resistant Genes, Diarrhea, PCR.
Diarrheal diseases are on the rise worldwide, with an estimated 1.6 million deaths annually affecting children under five years of age (Troeger et al., 2018). Kotloff et al. (2013) reported that this increase is due to several microbial pathogens, including Vibrio cholerae, Escherichia coli, Salmonella, Shigella, and Clostridioides difficile (C. difficile), which contribute to both healthcare-associated infections and community-acquired (Kotloff et al., 2013). It has been reported the main cause of antibiotic-associated diarrhea, especially nosocomial infections, is C. difficile (Carroll &Bartlett, 2011). This bacterium is a motile, rod-shaped, Gram-positive bacterium previously confirming that thirteen of the 100 identified species of Clostridium are considered to be extremely harmful to humans or animals (Dupuy et al., 2006).
Several studies have confirmed that the overuse of antibiotics, especially without a prescription, can significantly alter the gut microbiota (Baines et al., 2015; Sun &Hirota, 2015). This disruption in the gastrointestinal tract increases the host’s susceptibility to infection, particularly C. difficile infection (Sun &Hirota, 2015). The use of certain antibiotics, including clindamycin, ampicillin, penicillin, tetracycline, and cephalosporins, has been associated with a high risk of C. difficile infection (Khashei et al., 2018). The standard first-line treatment for C. difficile infections typically involves metronidazole and vancomycin (Canas et al., 2023). However, antibiotic resistance to these medications has been reported, complicating treatment and making CDI management more challenging (Di et al., 2015). Moreover, recent research has also shown that commonly used antibiotics used to treat diarrhea, such as clindamycin and fluoroquinolones, and occasionally even the first-line treatment vancomycin development of C. difficile (Canas et al., 2023). The ability of C. difficile to antibiotic resistance, along with its toxin production, expresses the severity of C. difficile infection (CDI) and makes it a significant public health (Baines et al., 2015).
Recently, antibiotic resistance mechanisms in C. difficile have become a significant concern due to the emergence of various mechanisms (Van et al., 2008). The presence of the erm (B) and erm (C) genes in this bacterium encode rRNA methylases that modify the target site, conferring resistance to macrolides such as erythromycin (Cassandra et al., 2020). Additionally, the erm(B) gene also reduces the efficacy of clindamycin by encoding an rRNA methylase (Miele et al.,1995). Resistance to metronidazole has been associated with mutations in the rdxA and frxA genes, which are involved in this bacterium activation. Moreover, the acquisition of β-lactamase genes, such as blaOXA-11 and blaOXA-48, has led to resistance to cephalosporins, including the Cefixime (Boekhoud et al., 2021). Additionally, the presence of vanB and vanG operons in some C. difficile isolates enables modification of the peptidoglycan cell wall target, thereby reducing the efficacy of vancomycin (Lessa et al., 2015). These antibiotic resistance genes poses are often located on plasmids and transposons which are mobile genetic elements, facilitating their spread between different C. difficile strains and even other bacterial species. This poses a significant public health threat, as it limits the available treatment options for serious C. difficile infections (Canas et al., 2023).
Several studies have highlighted a concerning rise in infections among humans and animals leading to the overuse of antibiotics without prescription in Duhok Governorate, located in the Kurdistan Region of Iraq (Saeed and Ibrahim, 2013; Hasan and Ibrahim, 2022; Hami and Ibrahim, 2023; Ibrahim, 2023; Mohialdeen & Ghaffar, 2023; Issa, 2024; Taher and Othman, 2024). This widespread and often unnecessary use of antibiotics has raised significant public health concerns, particularly regarding the development of antibiotic resistance which has vice versa to affect the gut microbiome. To the best of our knowledge, this study represents the first attempt to detect antibiotic-resistant genes in C. difficile by analyzing DNA extracted from stool samples using the PCR (polymerase chain reaction) technique. This research aims to shed light on the prevalence of antibiotic resistance in C. difficile, contributing to a better understanding of the challenges posed by antimicrobial resistance in the region.
2. MATERIALS AND METHODS
Stool Samples and DNA Extraction:
Thirteen bacterial DNA samples were extracted from stool specimens of diarrheic pediatric patients diagnosed with C. difficile. This study was conducted at Hivi Pediatric Teaching Hospital in Duhok, Iraq, between October 2021 and May 2022. These identified samples were part of a larger cross-sectional study that involved the collection of 200 stool samples from children suffering from diarrhea aged from 6 months to 6 years.
All samples were treated using a stool transport and recovery buffer (S.T.A.R, Roche, Mannheim, Germany) prior to DNA extraction, following the manufacture protocol of a High Pure PCR Template Preparation kit (Roche, Germany). DNA concentration was achieved using a Nanodrop DeNOVIX (Wilmington, USA) with values ranging from 120 to 256 µg/µL. The purity ratios of both 260/280 and 230/280 were falling between 1.95 and 2.2. Then, this DNA was immediately stored to preserve its integrity and ensure a high-quality yield for further DNS amplification.
The purified DNA extracts of 13 C. difficile from hospitalized diarrheic children (10 hospital-acquired and 3 community-acquired) previously identified by RT-PCR direct detection of C. difficile 16S rDNA using the following primers: CIDIF-F CTT GAA TAT CAA AGG TGA GCC A and CIDIF-R CTA CAA TCC GAA CTG AGA GTA (Eurofins, Ebersberg, Germany) (Kikuchi et al., 2002). were analyzed for 5 different drug-resistance genes using the conventional PCR technique (Table 1).
PCR technique:
In this study, these 13 samples diagnosed with C. difficile, were analyzed using Polymerase Chain Reaction (PCR) to detect five antibiotic resistance genes. Five specific different primers (Macrogen- South Korea) were employed to amplify genes associated with resistance to clindamycin, erythromycin, metronidazole and vancomycin. The targeted genes included Beta lactam Cefotaximase-Munich gene (blaCTX-M), Erythromycin Ribosomal Methylase C gene (ermC), Erythromycin Esterase A gene [ere(A)], Oxygen-insensitive NADPH Nitroreductase A gene (rdxA) and Vancomycin resistance Regulatory Protein R gene (vanR) as described in (Table 1).
The PCR amplification was performed using an Applied Biosystems 9700 thermal cycler (USA). Each reaction contented of 2X PCR master mix (Roche-Germany), 1μL of 20 pmol/μL each forward and reverse primers (Eurofins, Ebersberg, Germany), 2μL template DNA, and 7μL nuclease-free water to up to 20μL for reaction. The amplification was conducted considering the following circumstances: initial denaturation at 94°C for 5 minutes, followed by 35 denaturation cycles at 94°C for 30 seconds, annealing at different temperatures for 30 seconds, elongation at 72°C for 1 minute, and final extension at 72 °C for 10 minutes.
Following amplification, the PCR products were separated by agarose gel electrophoresis (Cleaver, UK). The amplicons, ranging between 299 and 850 base pairs, were visualized under UV light, and images were captured to confirm the presence of the target genes, as illustrated in Table 1.
Ethical Approval :
The Research Ethics Committee of the Duhok Directorate of General Health provided ethical permission. No.13072021-7-7.
Statistical
analysis:
The presence of antibiotic-resistance genes among isolates (http://bioinformatics.psb.ugent.be/webtools/Venn/).
Table 1: List of primers used for amplification of antibiotics resistant genes with their amplicon sizes and annealing temperatures
Antibiotics |
Target genes |
Primer sequences |
Amplicon |
Annealing (°C) |
References |
|
|
Cefotaxime |
BlaCTX-M |
F: 5’TTTGCGATGTGCAGTACCAGTAA-3’ |
590 |
55 |
(Sidjabat et al., 2009) |
||
R: 5’CGATATCGTTGGTGGTGCCATA-3’ |
|||||||
Clindamycin |
ermC |
F: 5′ AATCGTCAATTCCTGCATGT-3′ |
299 |
52 |
(Khashei et al., 2018) |
||
R: 5′ TAATCGTGGAATACGGGTTTG-3′ |
|||||||
Erythromycin |
ere(A) |
F: 5’ GCCGGTGCTCATGAACTTGAG 3’ |
419 |
58 |
(Van et al., 2008) |
||
R: 5’ CGACTCTATTCGATCAGAGGC 3’ |
|||||||
Metronidazole |
rdxA |
F: 5’ AATTTGAGCATGGGGCAGA 3’ |
850 |
55 |
(Ossenkopp et al., 1999) |
||
R: 5’ GAAACGCTTGAAAACACCCCT 3’ |
|||||||
Vancomycin |
vanR |
F: 5’ AGCGATAAAATACTTATTGTGGA 3’ |
645 |
54 |
(Bandera et al., 1995) |
||
R: 5’ CGGATTATCAATGGTGTCGTT 3’ |
3. RESULTS
PCR analysis showed distinct patterns of antibiotic resistance genes among detected C. difficile in the faecal samples, as shown in Table 2 and Figure 1. Among these 13 samples, the CTX-M gene was detected in all samples (100%), indicating resistance to cefotaxime. Resistance to clindamycin, mediated by the ermC gene, was detected in 10 samples (76.9%) and, to a lesser extent, the ere(A) gene linked to erythromycin resistance was observed in 9 samples (69.2%). In contrast, the prevalence of resistance genes to metronidazole (rdxA) and vancomycin (vanR) was lower, with only 1 sample (7.69%) and 2 samples (15.38%) detected for rdxA and vanR, respectively. These findings indicate a high prevalence of resistance to cefotaxime, clindamycin, and erythromycin among the tested C. difficile, with significantly lower resistance rates observed for metronidazole and vancomycin.
Figure 1: Conventional PCR for identifying genes that are resistant to antibiotics. M: marker (100 bp DNA ladder); lane 1: ere (A) gene; lane 2: ermC gene; lanes 3: CTX-M gene; lane 4: rdxA genes and lane 5: vanR gene.
Table2: Results of resistance genes of C. difficile by PCR.
Isolate |
CTX-M |
ermC |
ere(A) |
rdxA |
vanR |
CA-D17 |
+ |
+ |
+ |
- |
- |
CA-D26 |
+ |
+ |
+ |
- |
- |
CA-D42 |
+ |
+ |
+ |
- |
- |
HA-D13 |
+ |
+ |
+ |
+ |
+ |
HA-D21 |
+ |
+ |
- |
- |
- |
HA-D24 |
+ |
- |
+ |
- |
- |
HA-D50 |
+ |
+ |
- |
- |
- |
HA-D76 |
+ |
- |
+ |
- |
- |
HA-D87 |
+ |
+ |
- |
- |
+ |
HA-D110 |
+ |
- |
- |
- |
- |
HA-D309 |
+ |
+ |
+ |
- |
- |
HA-D383 |
+ |
+ |
+ |
- |
- |
HA-D389 |
+ |
+ |
+ |
- |
- |
Average |
100% |
76.90% |
69.20% |
7.69% |
15.38% |
+ = present, - = absent
The distribution of antibiotic resistance genes among detected C. difficile was further analyzed by Venn diagram software (Figure 2). A total of 6 samples possess three genes: CTX-M, ermC, and ere(A), followed by 2 samples possessing two genes, CTX-M and ermC as well as another 2 samples having CTX-M and ere(A). In addition, one samples possess all strain in contrast one sample only have one gene CTX-M.
Figure 2: Resistant genes carried by C. difficile: ere (A) gene for erythromycin; ermC gene for CTX-M gene for vefotaxime; rdxA gene for metronidazole. Clindamycin and vanR gene for vancomycin
4. DISCUSSION
This cross-sectional study aimed to detect drug-resistant genes among C. difficile from both community and hospital-acquired diarrheic children against commonly prescribed antibacterial genes. Cefotaxime resistance was highly prevalent, being present in all 13 isolates (100%). This suggests that cefotaxime resistance is widespread in the area due to the production of extended beta-lactamase enzymes (ESBLs), such as bla-CTM-M genes carried on plasmids, which can be easily spread via the conjugation process (Hassan and Ibrahim, 2022). The result was lower than those found by Boekhoud et al. (2021) in the Netherlands, who reported a resistance rate of 35.5% in C. difficile. This disparity in outcomes can be ascribed to differences in antibiotic usage policies. In our region, antibiotics are easily accessible without a physician's prescription and are widely prescribed without proper control. Among the studied C. difficile, 76.9% and 69.2% were positive for resistant genes against clindamycin and erythromycin, respectively. Clindamycin is effective against anaerobic Gram-negative bacilli, which are the predominant normal flora of the colon and create a symbiotic environment that allows C. difficile (Duffy et al., 2020). The results of the current study were similar to those of Tamma et al (2022), who found that 60% of C. difficile isolates were resistant to clindamycin. Erythromycin resistance ranges from 40 to 80% globally, which aligns with the results of this study.
Metronidazole resistance was
observed in only one of the 13 C. difficile isolates (7.69%). This
suggests that metronidazole continues to be an effective treatment option for C.
difficile infections, likely due to the relatively low occurrence of
resistance mechanisms. These findings are consistent with a study conducted by
Lessa et al (2015), who reported that metronidazole resistance in C.
difficile isolate is generally low, with resistance rates typically below
5% in most studies.
Our finding aligns with the results of Al-Rawe et al. (2023),
conducted in Iraq; they found that eight genes are present in all isolates and
contribute significantly to drug resistance through ribosome defence,
antibiotic efflux, and antibiotic deactivation. The authors concluded that mutations
in the functional domains of the tetA (P), tetM, and ermB genes were the most
promising new therapeutic targets.
Similarly, vancomycin resistance was infrequent, with only two out of
the 13 C. difficile isolates showing resistance (15.38%). This aligns
with the results of Baines et al (2011), who found that vancomycin
resistance in C. difficile remains relatively uncommon, with most
studies indicating resistance rates under 5%. Vancomycin is a narrow-spectrum
antibiotic that is particularly effective against Gram-positive cocci and is
recommended for severe cases of pseudomembranous colitis when metronidazole
resistance is present.
However, it is worth noting that severe cases of C. difficile
infection are rare in our area. As a result, these antimicrobial drugs are not
commonly prescribed by physicians, but they remain effective treatment options.
In regards to the origin of the isolates, three out of thirteen isolates were
obtained from children with community-acquired diarrhea. All of these isolates
tested positive for resistant genes against cefotaxime, clindamycin, and
erythromycin but negative for metronidazole and vancomycin. It is noteworthy
that the resistance gene with the lowest occurrence was metronidazole at 10%,
followed by vancomycin at 20%. Conversely, the highest percentage was observed
for cefotaxime at 100%, followed by clindamycin at 70% and erythromycin at 60%.
These findings clearly indicate the circulation of drug-resistant genes among
community-acquired infections, likely due to the extensive usage of
antibiotics. Moreover, it is important to acknowledge that these genes have the
potential to transfer among unrelated bacteria easily.
CONCLUSIONS
Based on this study's findings, it can be concluded that C. difficile isolates that circulated in the region commonly show antibiotic resistance genes, especially for cefotaxime, clindamycin, and erythromycin, which are commonly used antibiotics for various bacterial infections. However, lower levels of resistance were observed for metronidazole and vancomycin, providing reassurance regarding their effectiveness as first-line treatment options.
Acknowledgements:
The author thanks the Department of Biology, College of Science, University of Duhok, Duhok, Iraq.
Statements and Declarations:
Conflict of interest: The author declared no potential conflict of interest.
Consent to Participate: The author has consented to submit the article to this journal.
Consent to Publish: The author has agreed to publish the article in this journal.
Funding: This study did not receive specific funding from public, commercial, or non-profit organizations.
REFERENCES
Al-Rawe, A. M., Yousif, Y. I., Al-Jomaily, O. K. G., Shaban, S. A., & Suleiman, A. A. (2023). Identification of Antimicrobial Resistance Genes and Drug Targets in Antibiotic-Resistant Clostridioides difficile Clinical Isolates. Molecular Genetics, Microbiology and Virology, 38(3), 197-206. https://DOI.org/10.3103/S0891416823030023
Baines, S. D., & Wilcox, M. H. (2015). Antimicrobial resistance and reduced susceptibility in Clostridium difficile: potential consequences for induction, treatment, and recurrence of C. difficile infection. Antibiotics, 4(3), 267-298. https://DOI.org/10.3390/antibiotics4030267
Baines, S. D., Noel, A. R., Huscroft, G. S., Todhunter, S. L., O'Connor, R., & Aktories, K. (2011). Evaluation of linezolid and rifaximin as treatment options for experimental Clostridium difficile infection. Journal of Antimicrobial Chemotherapy, 66(1), 133-139. DOI: 10.1093/jac/dkr155
Boekhoud, I. M., Nieuwenhuis, M., Knetsch, C. W., Kumar, N., Swart, R. L., Corver, J., & Kuijper, E. J. (2021). Antibiotic resistance of Clostridioides difficile isolates in the Netherlands, 2017-2020. Antimicrobial Resistance & Infection Control, 10(1), 1-10. DOI: 10.3390/pathogens11080949
Canas-Durán, R., Pérez-Segarra, O., Mendoza-Oliva, A., Gálvez, J., & Rodríguez-Diaz, J. (2023). Antibiotic Resistance in Clostridioides difficile: Current Situation and Future Prospects. Microorganisms, 11(2), 341. https://DOI.org/10.1016/bs.apcsb.2021.11.003
Carroll K, C, Bartlett J, G (2011). Biology of Clostridium difficile: implications for epidemiology and diagnosis. Ann Rev Microbiol 65: 501-521. doi: 10.1146/annurev-micro-090110- 102824. DOI: 10.1146/annurev-micro-090110-102824
Cassandra R. Duffy.,Yongmei Huang., Maria Andrikopoulou., Conrad N. Stern-Asche.r., Jason D. Wright., Dena Goffman., Mary E. D’Alton., Alexander M. Friedman.(2020).Clindamycin, Gentamicin, and Risk for Clostridium difficile Infection and Acute Kidney Injury During Delivery Hospitalizations.Obstet Gynecol. 135(1): 59–67. DOI:10.1097/AOG.0000000000003568.
Debets-Ossenkopp, Y. J., Pot, R. G., Van Westerloo, D. J., Goodwin, A., Vandenbroucke-Grauls, C. M., Berg, D. E., ... & Kusters, J. G. (1999). Insertion of mini-IS 605 and deletion of adjacent sequences in the nitroreductase (rdxA) gene cause metronidazole resistance in Helicobacter pylori NCTC11637. Antimicrobial agents and chemotherapy, 43(11), 2657-2662. DOI: 10.1128/AAC.43.11.2657
Di, X., Bai, N., Zhang, X., Liu, B., Ni, W., Wang, J. & Wang, R. (2015). A meta-analysis of metronidazole and vancomycin for the treatment of Clostridium difficile infection, stratified by disease severity. Brazilian Journal of Infectious Diseases, 19, 339-349.DOI: 10.1016/j.bjid.2015.03.006
Dupuy, B., Govind, R., Antunes, A., & Matamouros, S. (2006). Clostridium difficile toxin synthesis is negatively regulated by TcdC. Journal of Medical Microbiology, 57(6), 685-689.DOI: 10.1099/jmm.0.47775-0
Ghaffar NM, Mohialdeen NH. Isolation and molecular characterization of Campylobacter jejuni from local broiler chicken (lbc) and frozen imported chickens (ifc) in duhok province, kurdistan region-iraq. Science Journal of University of Zakho. 2023 Aug 10; 11(3):386-95. DOI: 10.1099/jmm.0.47775-0
Hami, Iman A., and Khalid S. Ibrahim. "Incidence of methicillin-resistant Staphylococcus aureus (MRSA) recovered from patients with urinary tract infections in Zakho City/ Kurdistan-Iraq." Science Journal of University of Zakho 11.1 (2023): 91-97. DOI: https://DOI.org/10.25271/sjuoz.2023.11.1.1041
Hasan SM, Ibrahim KS. Molecular characterization of extended-spectrum β-lactamase (ESBL) and virulence gene factors in uropathogenic Escherichia coli (UPEC) in children in Duhok City, Kurdistan Region, Iraq. Antibiotics. 2022 Sep 14; 11(9):1246. DOI: 10.3390/antibiotics11091246
Ibrahim D. R. (2023). Prevalence of Plasmid Mediated QNRA, QNRB and QNRS Among Clinical Escherichia Coli Isolated from Urinary Tract Infections in Duhok, Kurdistan Region of Iraq. Science Journal of the University of Zakho. 11(4):523-31. https://DOI.org/10.25271/sjuoz.2023.11.4.1196
Issa F. A. (2024). Antibiotic Resistance Patterns of Common Uropathogens Isolated from Females at Zakho City, Kurdistan Region, Iraq. Science Journal of the University of Zakho.12(4):490-506. https://DOI.org/10.25271/sjuoz.2024.12.4.1395
Khashei R, Malekzadegan Y, Ebrahim-Saraie HS, Razavi Z. (2018). Phenotypic and genotypic characterization of macrolide, lincosamide and streptogramin B resistance among clinical isolates of staphylococci in southwest of Iran. BMC Res. Notes 11: 711. DOI: 10.1186/s13104-018-3817-4
Kikuchi, E., Miyamoto, Y., Narushima, S., & Itoh, K. (2002). Design of Species‐specific primers to identify 13 species of Clostridium harbored in human intestinal tracts. Microbiology and immunology, 46(5), 353-358. DOI: 10.1111/j.1348-0421.2002.tb02706.x
Lessa, F. C., Mu, Y., Bamberg, W. M., Beldavs, Z. G., Dumyati, G. K., Dunn, J. R.and Fridkin, S. K. (2015). Burden of Clostridium difficile infection in the United States. New England Journal of Medicine, 372(9), 825-834. DOI: 10.1056/NEJMoa1408913.
Mehdi L. Y and AL-Mossawei M. T. (2015). PCR for detection of Clostridium difficile toxin A (tcdA) and toxin B (tcdB) genes in Iraq. Journal of Health, Medicine and Nursing 87: 57-68.
Miele, A., Bandera, M., & Goldstein, B. P. (1995). Use of primers selective for vancomycin resistance genes to determine van genotype in enterococci and to study gene organization in VanA isolates. Antimicrobial agents and chemotherapy, 39(8), 1772-1778. DOI: 10.1128/aac.39.8.1772
Mohialdeen N. H and Ghaffar N. M. (2023). Isolation and molecular characterization of Campylobacter jejuni from local broiler chicken (lbc) and frozen imported chickens (ifc) in duhok province, kurdistan region-iraq. Science Journal of University of Zakho. 11(3):386-95. https://DOI.org/10.25271/sjuoz.2023.11.3.1136
Ofosu, A. (2016). Clostridium difficile infection: a review of current and emerging therapies. Annals of gastroenterology: quarterly publication of the Hellenic Society of Gastroenterology, 29(2), 147. DOI: 10.20524/aog.2016.0006
Owens J, R. C., Donskey, C. J., Gaynes, R. P., Loo, V. G., & Muto, C. A. (2008). Antimicrobial-associated risk factors for Clostridium difficile infection. Clinical Infectious Diseases, 46(Supplement_1), S19-S31. https://DOI.org/10.1086/521859
Saeed A.Y. and Ibrahim, K. S. (2013). Detection of Enterohemorrhagic Escherichia Coli O157 in Sheep and Goats Using Fluorogenic and Chromogenic Culture Media. Science Journal of University of Zakho. 1(1):115-9.
Sidjabat, H. E., Paterson, D. L., Adams-Haduch, J. M., Ewan, L., Pasculle, A. W., Muto, C. A., ... & Doi, Y. (2009). Molecular epidemiology of CTX-M-producing Escherichia coli isolates at a tertiary medical centre in western Pennsylvania. Antimicrobial agents and chemotherapy, 53(11), 4733-4739. DOI: 10.1128/AAC.00533-09
Sun, X., & Hirota, S. A. (2015). The roles of host and pathogen factors and the innate immune response in the pathogenesis of Clostridium difficile infection. Molecular immunology, 63(2), 193-202. DOI: 10.1016/j.molimm.2014.09.005
Sun, X., & Hirota, S. A. (2015). The roles of host and pathogen factors and the innate immune response in the pathogenesis of Clostridium difficile infection. Molecular immunology, 63(2), 193-202. DOI: 10.1016/j.molimm.2014.09.005
Taher F. S. and Othman H. E. (2024). Molecular identification and genotyping of methicillin-resistant staphylococcus aureus (mrsa) in different clinical samples. Science Journal of University of Zakho. 12(2):159-68.https://DOI.org/10.25271/sjuoz.2024.12.2.1276
Tamma, P. D., Antel, A. S., Avdic, E., Carroll, K. C., Mikolajczak, A., Natarajan, K., ... & Simner, P. J. (2022). Clostridium difficile infection: epidemiology, diagnosis, and antimicrobial susceptibility testing. Journal of Clinical Microbiology, 60(6), e00518-22. DOI: 10.1038/nrgastro.2016.25
Tao, S., Chen, H., Li, N., Wang, T., & Liang, W. (2022). The spread of antibiotic resistance genes in vivo model. Canadian Journal of Infectious Diseases and Medical Microbiology, 2022(1), 3348695. DOI: 10.1155/2022/3348695
Van, T. T. H., Chin, J., Chapman, T., Tran, L. T., and Coloe, P. J. (2008). Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. International journal of food microbiology, 124(3), 217-223. DOI: 10.1016/j.ijfoodmicro.2008.03.029
Yahav, D., Koay, T. H., Karnik, N. D., & Adler, A. (2023). Antimicrobial resistance in Clostridioides difficile infection: A narrative review. Antimicrobial Resistance & Infection Control, 12(1), 1-12. DOI: 10.1186/s13756-020-00815-5
* Corresponding author
This is an open access under a CC BY-NC-SA 4.0 license (https://creativecommons.org/licenses/by-nc-sa/4.0/)